ChemicalInstance[chemical,<|qual1val1,qual2val2,|>]
represents a chemical whose qualifiers quali have values of vali.
ChemicalInstance[chemical,quantity]
represents a chemical quantified by quantity.
ChemicalInstance
ChemicalInstance[chemical,<|qual1val1,qual2val2,|>]
represents a chemical whose qualifiers quali have values of vali.
ChemicalInstance[chemical,quantity]
represents a chemical quantified by quantity.
Details
- Possible forms for chemical include:
-
Atom[…] an atom BioSequence[…] a biomolecular sequence ChemicalFormula[…] a molecular entity with the given formula Entity[…] a chemical entity ExternalIdentifier[…] an external identifier Molecule[…] a molecule "identifier" a systematic chemical name, SMILES or InChI string - Chemical entities include "Chemical", "Element", "Isotope", "Mineral" and "Protein".
- Typical quali qualifiers include:
-
"Amount" amount of substance "AtomCount" number of atoms "Mass" mass "MassDensity" density "MoleculeCount" number of molecules "Phase" phase of matter "Pressure" pressure "Temperature" temperature "Volume" volume - The quali can be physical quantity names, a QuantityVariable expression or a "PhysicalQuantity" Entity.
- Properties "prop" of a ChemicalInstance obtained by ChemicalInstance[…]["prop"] include:
-
"Amount" amount of substance "AtomCount" number of atoms "Chemical" chemical object "Mass" mass "MoleculeCount" number of molecules "Quantity" quantity object "Volume" volume - ChemicalInstance[chemical,assoc]["prop"] will return the value for the specified property in assoc.
Examples
open all close allBasic Examples (2)
Represent a solid silver nanoparticle containing 40 atoms:
ChemicalInstance[Entity["Element", "Silver"], <|"Atoms" -> Quantity[40, "Atoms"], "Phase" -> "Solid"|>]Represent a measured amount of tin(IV) oxide using a milligram balance:
ChemicalInstance[Entity["Chemical", "TinIVOxide"], <|"Mass" -> Quantity[Around[14.583, 0.0009], "Grams"]|>]ChemicalInstance[Entity["Chemical", "TinIVOxide"], Quantity[Around[14.583, 0.0009], "Grams"]]Scope (10)
Chemical Objects (6)
Represent a gold nanoparticle containing 30 atoms:
ChemicalInstance[Atom["Au"], Quantity[30, "Atoms"]]Represent 3 milligrams of a DNA sequence:
ChemicalInstance[BioSequence["DNA", "ATAAACGTACGTTTTTAGGCT"], Quantity[3, "Milligrams"]]Represent 3 mL of a new chemical with an empirical formula of
:
ChemicalInstance[ChemicalFormula["PaC8H8"], Quantity[Around[3., 0.1], "Milliliters"]]Represent 50 micrograms of plutonium-239:
ChemicalInstance[Entity["Isotope", "Plutonium239"], Quantity[50, "Micrograms"]]Represent solid uranium(VI) oxide using an ExternalIdentifier:
ChemicalInstance[Molecule[ExternalIdentifier["PubChemCompoundID", 74013]], <|"Phase" -> "Solid"|>]Represent 6 millimoles of tungsten hexamethyl:
ChemicalInstance[Molecule["C[W](C)(C)(C)(C)C"], Quantity[6, "Millimoles"]]Properties (4)
ChemicalInstance[Molecule["1,3-butadiene"], <|"Volume" -> Quantity[3, "Milliliters"], "MassDensity" -> Quantity[Around[0.64, 0.01], "Grams"/"Milliliters"], "Temperature" -> Quantity[-6, "DegreesCelsiusDifference"]|>]["Chemical"]ChemicalInstance[Entity["Chemical", "Water"], Quantity[Around[5.1, 0.05], "Milliliters"]]["Chemical"]ChemicalInstance[Molecule["1,3-butadiene"], <|"Volume" -> Quantity[3, "Milliliters"], "MassDensity" -> Quantity[Around[0.64, 0.01], "Grams"/"Milliliters"], "Temperature" -> Quantity[-6, "DegreesCelsiusDifference"]|>]["Quantity"]ChemicalInstance[Entity["Chemical", "Water"], Quantity[Around[5.1, 0.05], "Milliliters"]]["Quantity"]Compute the quantity corresponding to an extensive physical property:
ChemicalInstance[Entity["Chemical", "ManganeseIVOxide"], Quantity[30, "Grams"]]["Amount"]ChemicalInstance[Entity["Chemical", "ManganeseIVOxide"], Quantity[30, "Grams"]]["MoleculeCount"]ChemicalInstance[Entity["Chemical", "ManganeseIVOxide"], Quantity[30, "Grams"]]["Volume"]Get a chemical property using any qualifying data that is present:
ChemicalInstance[Entity["Chemical", "PenicillinV"], <|"MassDensity" -> Quantity[Around[1.441, 0.005], "Grams" / "Centimeters"^3], "Volume" -> Quantity[Around[5.1, 0.05], "Milliliters"]|>]["MassDensity"]ChemicalInstance[Entity["Chemical", "PenicillinV"], Quantity[Around[5.1, 0.05], "Milliliters"]]["MassDensity"]Generalizations & Extensions (2)
Compute the volume symbolically when the density is unknown:
ChemicalInstance[ChemicalFormula[{"U" -> 1, "O" -> 2, {"H" -> 2, "O" -> 1} -> 5}, Association["NetCharge" -> 2]], <|"Mass" -> Quantity[2, "Milligrams"], "MassDensity" -> Quantity[, "Grams" / "Milliliters"]|>]["Volume"]Compute the amount of substance symbolically:
ChemicalInstance[BioSequence["DNA", "ATAAACGTACGTTTTTAGGCT", {}], <|"Mass" -> Quantity[25, "Micrograms"], "MolarMass" -> Quantity[, "Grams" / "Moles"]|>]["Amount"]Applications (1)
Compare the number of atoms in 2 mg of each stable isotope of tin:
BarChart[Map[ChemicalInstance[#, Quantity[2, "Milligrams"]]["AtomCount"]&, {Entity["Isotope", "Tin120"], Entity["Isotope", "Tin118"], Entity["Isotope", "Tin116"], Entity["Isotope", "Tin119"], Entity["Isotope", "Tin117"], Entity["Isotope", "Tin124"], Entity["Isotope", "Tin122"], Entity["Isotope", "Tin112"], Entity["Isotope", "Tin114"], Entity["Isotope", "Tin115"]}]]Possible Issues (2)
Computed properties require a quantity stored under a key corresponding to a physical quantity:
ChemicalInstance[Entity["Chemical", "Methane"], <|"Phase" -> "Gas"|>]["Amount"]Properties of a chemical at a nonstandard temperature and pressure may be unavailable:
ChemicalInstance[Entity["Chemical", "1Butanol"], <|"Volume" -> Quantity[1, "Liters"], "Temperature" -> Quantity[400, "Kelvins"]|>]["Amount"]See Also
Related Guides
History
Text
Wolfram Research (2022), ChemicalInstance, Wolfram Language function, https://reference.wolfram.com/language/ref/ChemicalInstance.html.
CMS
Wolfram Language. 2022. "ChemicalInstance." Wolfram Language & System Documentation Center. Wolfram Research. https://reference.wolfram.com/language/ref/ChemicalInstance.html.
APA
Wolfram Language. (2022). ChemicalInstance. Wolfram Language & System Documentation Center. Retrieved from https://reference.wolfram.com/language/ref/ChemicalInstance.html
BibTeX
@misc{reference.wolfram_2026_chemicalinstance, author="Wolfram Research", title="{ChemicalInstance}", year="2022", howpublished="\url{https://reference.wolfram.com/language/ref/ChemicalInstance.html}", note=[Accessed: 05-September-2026]}
BibLaTeX
@online{reference.wolfram_2026_chemicalinstance, organization={Wolfram Research}, title={ChemicalInstance}, year={2022}, url={https://reference.wolfram.com/language/ref/ChemicalInstance.html}, note=[Accessed: 05-September-2026]}