BioSequencePlot[bioseq]
creates a two-dimensional schematic diagram of the biomolecular sequence bioseq.
BioSequencePlot
BioSequencePlot[bioseq]
creates a two-dimensional schematic diagram of the biomolecular sequence bioseq.
Details and Options
- BioSequencePlot returns a Graphics expression.
- BioSequencePlot will automatically adjust the level of detail shown to produce a graphic of reasonable size.
- BioSequencePlot has the same options as GraphPlot.
-
AlignmentPoint Center the default point in the graphic to align with AspectRatio Automatic ratio of height to width Axes False whether to draw axes AxesLabel None axes labels AxesOrigin Automatic where axes should cross AxesStyle {} style specifications for the axes Background None background color for the plot BaselinePosition Automatic how to align with a surrounding text baseline BaseStyle {} base style specifications for the graphic ContentSelectable Automatic whether to allow contents to be selected CoordinatesToolOptions Automatic detailed behavior of the coordinates tool DataRange Automatic the range of vertex coordinates to generate DirectedEdges False whether to interpret Rule as DirectedEdge EdgeLabels None labels and label placements for edges EdgeLabelStyle Automatic style to use for edge labels EdgeShapeFunction Automatic generate graphic shapes for edges EdgeStyle Automatic styles for edges Epilog {} primitives rendered after the main plot FormatType TraditionalForm the default format type for text Frame False whether to put a frame around the plot FrameLabel None frame labels FrameStyle {} style specifications for the frame FrameTicks Automatic frame ticks FrameTicksStyle {} style specifications for frame ticks GraphHighlight {} vertices and edges to highlight GraphHighlightStyle Automatic style for highlight GraphLayout Automatic how to lay out vertices and edges GridLines None grid lines to draw GridLinesStyle {} style specifications for grid lines ImageMargins 0. the margins to leave around the graphic ImagePadding All what extra padding to allow for labels etc. ImageSize Automatic the absolute size at which to render the graphic LabelStyle {} style specifications for labels Method Automatic method to use PerformanceGoal Automatic aspects of performance to try to optimize PlotLabel None an overall label for the plot PlotRange All range of values to include PlotRangeClipping False whether to clip at the plot range PlotRangePadding Automatic how much to pad the range of values PlotRegion Automatic the final display region to be filled PlotStyle Automatic graphics directives to determine styles PlotTheme Automatic overall theme for the graph PreserveImageOptions Automatic whether to preserve image options when displaying new versions of the same graphic Prolog {} primitives rendered before the main plot RotateLabel True whether to rotate y labels on the frame Ticks Automatic axes ticks TicksStyle {} style specifications for axes ticks VertexCoordinates Automatic coordinates for vertices VertexLabels None labels and label placements for vertices VertexLabelStyle Automatic style to use for vertex labels VertexShape Automatic graphic shape for vertices VertexShapeFunction Automatic generate graphic shapes for vertices VertexSize Automatic size of vertices VertexStyle Automatic styles for vertices
List of all options
Examples
open all close allBasic Examples (3)
Create a biomolecular sequence and plot it:
BioSequencePlot[BioSequence["DNA", "ATAATCTGT"]]Plot a biomolecular sequence with higher-order bonds:
BioSequencePlot[BioSequence["RNA", "GCCAGACUGAYAUCUGGA", {Bond[{2, 17}], Bond[{3, 16}], Bond[{4, 15}], Bond[{5, 14}], Bond[{6, 13}]}]]Plot the sequence of the circular peptide kalata B1, which has disulfide bonds:
BioSequencePlot[BioSequence["CircularPeptide", "GLPVCGETCVGGTCNTPGCTCSWPVCTRN", Bond /@ {{5, 19}, {9, 21}, {14, 26}}]]Scope (5)
Motifs of a hybrid strand can be identified by a change in color:
BioSequencePlot[BioSequence["HybridStrand", {BioSequence["DNA", "CAGT"], BioSequence["RNA", "GUA"]}, {Bond[{{1, 2}, {2, 2}}]}]]Multiple strands can all be plotted together:
BioSequencePlot[BioSequence[{BioSequence["HybridStrand", {BioSequence["DNA", "G"], BioSequence["DNA", "CCCC"], BioSequence["RNA", "G"], BioSequence["DNA", "TTTT"]}],
BioSequence["HybridStrand", {BioSequence["DNA", "AAAAA"], BioSequence["RNA", "U"], BioSequence["DNA", "GGGGG"]}]}, {Bond[{{1, 2, 2}, {2, 3, 3}}], Bond[{{1, 2, 3}, {2, 3, 2}}], Bond[{{1, 4, 2}, {2, 1, 3}}], Bond[{{1, 4, 3}, {2, 1, 2}}]}]]Longer sequences do not show letters by default, but instead provide further information in tooltips:
BioSequencePlot[BioSequence["DNA", "TTCCCCCTCTACGCGCCAGTAGGTCTAATAAAGCTACCTTCGTGACAATACTGCTGCTTTCTGCCTCCCTTGCAACGTAGAGGGTGCAGCCCGGTCGGCT", {}]]More complicated reduced structures have tooltips to aid navigation:
BioSequencePlot[BioSequence[{BioSequence["HybridStrand", {BioSequence["DNA", "ATCG"], InputForm[BioSequence["DNA", "CCCCCC"]], InputForm[BioSequence["RNA", "AUCG"]], InputForm[BioSequence["DNA", "TTTTTT"]], BioSequence["RNA", 50]}],
BioSequence["HybridStrand", {InputForm[BioSequence["DNA", "AAAAAA"]], InputForm[BioSequence["RNA", "UUUU"]], InputForm[BioSequence["DNA", "GGGGGG"]], BioSequence["RNA", "U"], BioSequence["RNA", 40]}]}, {Bond[{{1, 2, 2}, {2, 3, 5}}], Bond[{{1, 2, 3}, {2, 3, 4}}], Bond[{{1, 2, 4}, {2, 3, 3}}], Bond[{{1, 2, 5}, {2, 3, 2}}], Bond[{{1, 4, 2}, {2, 1, 5}}], Bond[{{1, 4, 3}, {2, 1, 4}}], Bond[{{1, 4, 4}, {2, 1, 3}}], Bond[{{1, 5, 5}, {2, 1, 2}}]}]]Very long sequences are grouped into ranges to avoid generating plots that are too large:
BioSequencePlot[BioSequence["RNA", StringRepeat["N", 1034], {Bond[{56, 718}], Bond[{143, 517}], Bond[{834, 1000}]}
]
]Neat Examples (1)
Repeated RNA pseudoknots demonstrate how the same structure is rendered at changing scales:
repeatedPseudoknot[n_] := BioSequencePlot[BioSequence["RNA", StringRepeat["GAUGGCACUCCCAUCAAUUGGAGC", n], StringRepeat["(((((..<<<))))).....>>>.", n]]]repeatedPseudoknot[1]repeatedPseudoknot[10]repeatedPseudoknot[200]See Also
BioSequence BioSequenceModify GraphPlot
Function Repository: BioSequenceMoleculePlot3D BioSequenceMoleculePlot
Related Guides
History
Text
Wolfram Research (2021), BioSequencePlot, Wolfram Language function, https://reference.wolfram.com/language/ref/BioSequencePlot.html.
CMS
Wolfram Language. 2021. "BioSequencePlot." Wolfram Language & System Documentation Center. Wolfram Research. https://reference.wolfram.com/language/ref/BioSequencePlot.html.
APA
Wolfram Language. (2021). BioSequencePlot. Wolfram Language & System Documentation Center. Retrieved from https://reference.wolfram.com/language/ref/BioSequencePlot.html
BibTeX
@misc{reference.wolfram_2026_biosequenceplot, author="Wolfram Research", title="{BioSequencePlot}", year="2021", howpublished="\url{https://reference.wolfram.com/language/ref/BioSequencePlot.html}", note=[Accessed: 30-July-2026]}
BibLaTeX
@online{reference.wolfram_2026_biosequenceplot, organization={Wolfram Research}, title={BioSequencePlot}, year={2021}, url={https://reference.wolfram.com/language/ref/BioSequencePlot.html}, note=[Accessed: 30-July-2026]}